CRISPR/Cas9 technology, using sgRNAs (targeting TATGTCTCTATGCAGATGCA and ACACTGACAGCCAGCTCTTT) and an ssODN template, generated a TACTAC to TTCTTC change in exon 5, resulting in tyrosine to phenylalanine substitutions at amino acids 137 and 138 (p.Y112_Y113delinsFF), and inserted (duplicated) a T further downstream, leading to a frameshift and premature stop codon (p.Gly145Leufs*18). (J:303558)
Basic Information
Insertion, Nucleotide substitutions
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count