Hsf2bp^em2Amp

CRISPR/Cas9 technology, using an sgRNA (targeting TCACAAAACTCTCCATCGTC and ATTGGATGGGGATGTCAAGG) and ssODN template, generated a C-to-T change at coding nucleotide 512 (c.512C>T) resulting in a serine to leucine substitution at amino acid 171 (p.S171L) that corresponds to the human p.S167L mutation found in a clinical case with primary ovarian insufficiency. Immunofluorescence shows reduced protein expression in testes lysates. (J:303558)