This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CACCTGAATGAACATCCACA and AACTGTGTATACCGTCCCCC, which resulted in a 1801 bp deletion beginning at Chromosome 4 position 119,169,330 bp and ending after 119,171,130 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000669588 (exon 2) and 271 bp of flanking intronic sequence including the splice acceptor, the ATG start site and 3 UTR, and is predicted to result in a null allele. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count