Using an sgRNA (targeting ATGTATTTCAGGTAGAAGTC) and an ssODN template (AGGTGAGCCTGATACTCGGCGGGCAATTTTCATGTAGATCTTTTAAACTTCTAATGAATGGCTTTCCCTTCTCAGATATCCTACAAGGAAACTTTAAACTGGACTTCTACCTGAAATACATTCAGAAGGATCTCCGCCTCGCCATTGCATTGGGTGATGCAGTCAACCACCCCACTCCCATGGCAGCTGCAGCCAATGAG) with CRISPR/Cas9 technology, proline codon 495 (CCT) was changed to leucine (CTG) (p.P495L). This mutation of the highly conserved proline residue in the beta-hydroxyacid dehydrogenase (betaHAD) domain mimics one found in some congenital heart disease (CHD) patients. (J:322763)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count