Plasmids encoding gRNAs (AGCACTAGACGTTGAGGTCA and GGCAGGCTTAAAGGCTAACC) are designed to insert a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter (CAG), followed by a floxed STOP cassette, and the DAF-TM sequence into the endogenous Gt(ROSA)26Sor locus. Specifically, the DAF-TM uses the Cd55 sequence containing the complement regulatory domain, in addition, the signal sequence for glycophosphatidylinositol-(GPI)-anchor addition is replaced with the nonsignaling transmembrane helix domain of human tissue factor. (J:314460)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count