Using an sgRNA (targeting CCACTTCCAGGGCTTTGACG) and an ssODN template (TGTGAAATGCTTCGGAGGTAGGAGGTGTGAGCGGAAGGCTTTATAGATAATGTGCTCCATAGTCCACTTCCAGGGCTTAGAGGTCGAGCCAGGCATGTCACTCTGGAAAATATATGACAC) with CRISPR/Cas9 technology, valine codon 720 (GTG) was changed to methionine (ATG) (c.2158G>A, p.V720M). This is the equivalent of the human p.V716M mutation. (J:324056)
Basic Information
FVB/NJ x B6(Cg)-Tyrc-2J/J
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count