Using an sgRNA (targeting GTCAGCTAAGGGCAGCATTG) and an ssODN template (GAAGAGAGCTGCCGCCTCATCGAAGCTCTGTCCTTGTCCCAGCTGCCATTTCAGTGTACTCATGGGAGACCATCTATGCTGCCCTTAGCTGACCTGGACCACTTGGAGCAGGAAAAACAG) with CRISPR/Cas9 technology, alanine codon 1356 (GCT) was changed to threonine (ACT) (c.4066G>A, p.A1356T). This is the equivalent of the human p.A1394T mutation. (J:324056)
Basic Information
FVB/NJ x B6(Cg)-Tyrc-2J/J
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count