CRISPR/cas9 mediated recombination using 2 guide RNAs (CTTGACAGGAATGCCATCGG and CATCGATGACCCAAATGGCC) targeting exons 5 and 7 was used to create a 252 bp deletion spanning nucleotides 614 - 865 including all of exon 6 and parts of exons 5 and 7. ELISA confirmed the absence of mature protein in plasma from homozygous mice. (J:323044)
Basic Information
NOD.Cg-Prkdcscid Il2rgtm1Sug/ShiJic
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count