CRISPR/Cas9 technology using sgRNAs targeting intron 1 (GTAAGATGTGGGTGGTACT) and intron 2 (TTACTAAGTATAGGGACAGG) deleted exon 2. Sequencing of RT-PCR products confirmed the production of mutant mRNAs from splicing exon 1 to exon 3, which leads to a frame-shift and is predicted to produce a truncated protein containing only the N-terminal region and lacking the homeodomain and the C-terminal Aristaless domain. Western blot analysis confirmed that embryos lack full-length protein and only produce truncated product that is expressed at low levels. (J:320497)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count