Using sgRNAs (targeting GTTCAGTGTACTTCAGTTGGNGG and TTCAGTGTACTTCAGTTGGTNGG) and an SSODN template (GGCCAGGTCCCGGTGCACGTAGTTCATGTTGGCCAGGTACTTCATGCCGGATGCGATACCCTGCAGCATGCCCACTAGCTGAAGTACACTGAACTCACCATCCTTCTCCTGCAGAGATAGGCCCTCAGTGCTGACCGG) with CRISPR/Cas9 technology, arginine codon 722 (AGG) in exon 13 was changed to glutamine (CAG) (p.R722Q). The equivalent p.R721Q human mutation is associated with age-related cortical cataract. (J:312486)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count