Using an sgRNA (targeting ATTTTTTACGGCAATGTCGA) and an ssODN template with CRISPR/Cas9 technology, cysteine codon 565 (TGT) in exon 15 was changed to tyrosine (TAT) (c.1694G>A, p.C565Y); also, two silent mutations were introduced to create a diagnostic AclI restriction site. This mutation mimics a human mutation associated with sensorineural hearing impairment (SNHI) but doesn't cause deafness in mouse. (J:321807)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count