Slc26a4^em1Chch

Using an sgRNA (targeting AAAGGACAGATTCTTTCTGA) and an ssODN template with CRISPR/Cas9 technology, threnonine codon 721 (ACG) in exon 15 was changed to methionine (ATG) (c.2162C>T, p.T721M); also, two silent mutations were introduced to create a diagnostic HinfI restriction site. This mutation mimics a human mutation associated with sensorineural hearing impairment (SNHI) but doesn't cause deafness in mouse. (J:313809)