CRISPR/cas9 genome editing used guide RNAs [TCCTGTCACACTATATTAGA, GCCATCTAATATAGTGTGAC, GTCAAGGGTTTTGATGTTCC and AACTCTGCAAACTCTGGTCC] to target exon 2. Donor DNAs were designed to delete exon 2 resulting in a change of amino acid sequence after residue 214 and an early truncation 9 amino acids later. (J:94077)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count