Using an sgRNA (targeting TCGGAGTCCTGGTGCCTCCT) and an ssODN template (TCCTGAGGGCTATGTGGGCTCAGGAGACTAGAGGCTGGGTCGACAAGAGTCTGTTCCGAGGAGGCAGGCGGACTCCGAGTCTAAGTCAGGCTTTGGATCCATTTCCATTTCTTCCTTTGCTGTCTGGGT) with CRISPR/Cas9 technology, tryptophan codon 972 (TGG) in exon 22 was changed to alanine (GCC)(p.W972A). This mutation in the LC3-interacting region (LIR) of the encoded peptide prevents binding to this domain. (J:314513)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count