Using sgRNA (targeting GCACGATGAAGACGTACCTG) and an ssODN template with CRISPR/Cas9 technology, valine codon 61 (GTC) in exon 2 was changed to leucine (CTC) (c.181G>C, p.V61L). This mutation mimics the human p.V60L mutation associated with a form of dominant early-onset progressive sensorineural hearing loss (DFNA41). (J:315007)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count