Using an sgRNA (targeting TGGTGAACATCACATAATCT in exon 8) with CRISPR/Cas9 technology resulted in the insertion of an A into aspartic acid codon 461, causing a frameshift that eliminates zinc fingers 5 and 6 from the encoded peptide. The allele was created in fertilized eggs carrying the Ikzf3em1Itan allele. (J:319672)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count