Using an sgRNA (targeting GCAGTTTAATATGACGGAGG in exon 4) and an ssODN template (CCTTGTGATCAGCGATCTCCTTTTTCCTCCTTTCTGAAGGCGAACGCCCGTTCCAGTGTAATCAGTGCGGGGCATCTTTTACTCAGAAACGTAATCTCCTCCGTCATATTAAACTGCACACGGGGGAAAAACCTTTTAAGTGTCACCTCTGCAACTACGCATGCCAAAGGAGAGATGCGCTCACGGGACACCTTAGGACA) with CRISPR/Cas9 technology, a G>C mutation was engineered in glycine codon 158, changing it to arginine (p.G158R), to mimic a mutation (p.G159R) found in human patients with adaptive immunity defects (B cell developmental deficiencies and T cell abnormalities). (J:319672)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count