CRISPR/cas9 genome editing used guide RNAs (TATAAAGAAGCAATGCTGCAA, AAGAAGCAATGCTGCAAGTGA, and GAAGCAATGCTGCAAGTGAG) to target exon 5. Donor DNAs were created encoding a C1186Y mutation (TGC to TAC, cysteine to tyrosine). C1186Y is orthologous to the clinical mutation C1189Y associated with Wiedemann-Steiner Syndrome. (J:94077)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count