CRISPR/cas9 genome editing used guide RNAs upstream (GGACCTGTAGTTTGAAATTC and GAATTTCAAACTACAGGTCC) and downstream (AGTAAGGATGATTGCAGCCC and GCTCACACAGTTTCCTGGCC) selected to target exon 2, sequencing identified a 414 nt deletion (indel mutation) that eliminates exon 2 creating a null allele. (J:94077)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count