CRISPR/cas9 genome editing uses guide RNAs (CCCTCTGTGCAGTGGGACCA, GTGCAGTGGGACCAAGGCTC, and AGTCTCACCGGCCTGAGCCT) were selected to target exon 11. Donor DNAs were created encoding a Q306X mutation (CAA to TGA, glutamine to stop). The orthologous clinical mutation R306X is associated with hereditary spastic paraplegia. (J:94077)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count