CRISPR/cas9 genome editing uses a guide RNA (GGTAGTCTACGCTCACAGCA) to target exon 4. The resulting indel mutation was identified as a 1 bp insertion (A) in the PAM site at aa 229. The mutation creates a frameshift mutation. (J:94077)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count