Using an sgRNA (AGGTGCGAACCAGAGCCTTG) and an ssODN template (CACCCCACCCTGCCCATACCCCTCCTTACCACCAAGACGTGTTCTAGTAGGTCCAGGTAGCCCAAGGTGCATTCTGTGCCATAATGCAAGGCTCTGGTTCGCACCTCTTCACTGACATCAGGGTA) with CRISPR/Cas9 technology, a mutation was engineered (arginine codon 2239 CGG to histidine CAT, p.R2239H) that mimics a human variant found to be protective for the atrial septal defect (ASD)-causing TPM1 p.K5del mutation in human patients. (J:320916)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count