Using an sgRNA (CTTCTTGATGGCGTCCATGG) and an ssODN template (TCCGCTGCCTAAGGGCCCCTCGCCACCGCCACCATGGACGCCATCAAGAAGATGCAGATGCTGAAGCTCGACAAAGAGAACGCCTTGGATCGAGCTGAGCAAGCGGAGGCTGATAAGAAGGCGGC) with CRISPR/Cas9 technology, a mutation was engineered (deletion of one of lysine codons 5, 6 or 7 [p.K5del, p.K6del, p.K7del]) to mimic one linked to atrial septal defect (ASD) in human patients. (J:320916)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count