CRISPR/cas9 genome editing using guide RNAs upstream (GTATTTACTAAAGGACTGTC and CTAAAGGACTGTCAGGAATC) and downstream (ATGAGCCTTCTTCCTAGGCC and CCTGTCAGAGATCCAGGCCT) were selected to target exon 2. Donor DNAs were originally designed to insert a G192R mutation and a silent mutation N196N in exon 2. DNA sequencing of the targeted region identified founder 6951 with an 11 bp deletion (indel). This strain does not contain the point mutations. (J:94077)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count