CRISPR/cas9 genome editing is used to generate a 390 nucleotide deletion that results in the complete loss of exon 5. Guide RNAs were selected to target upstream [ACTTTCCTATAACCCCAAGT ; CTTGGGAGTGACACCTACTT] and downstream [AAGTAGATTTAGATAAAACT ; AGTAGATTTAGATAAAACTT] of exon 5. (J:101977)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count