CRISPR/cas9 genome editing is used to delete exon 3, Guide RNAs were selected to target upstream [AGCCAGTCCGCCACTAAAAT ; GACCTATTTTAGTGGCGGAC] and downstream [CCCCCCGGTTACTTGTGATT ; CACCTAATCACAAGTAACCG] of exon 3. Progeny were screened by DNA sequencing of the targeted region, which identified founder 3628 harboring a complete loss of exon 3. (J:101977)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count