CRISPR/Cas9 technology generated a 22-bp deletion (CTTTGGACTACATCGTGAACGC) that includes the miR-455-5p mature sequences. Neither miR-455-5p nor miR-455-3p are expressed in primary chondrocytes. Although miR-455 is located in intron 10 of Col27a1, expression of Col27a1 is not changed in chondrocytes indicating that Col27a1 is not affected by this deletion. (J:320585)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count