CRISPR/cas9 genome editing using guide RNAs in the upstream (ACTTATACCATCAGTTAGAT; AGCAGGACCAATCTAACTGA) and downstream (CTGCTGGCTCATAGTGTGCG; CCCGCACACTATGAGCCAGC) regions of exon 4 originally designed to create a floxed conditional line instead created a 553 bp deletion incorporating exon 4 (TCTGCTTAAAGCAGGACCAATCT/del553/GCGGGGTAGCATTTAAAGGCAGCAC). (J:101977)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count