CRISPR/Cas9 methodologies is used to incorporate an E344K (also designated E326K) (GAG to AAG) knock-in in exon 8 (NM_001077411.4) and 2 silent mutations: wildtype CCAAAGCTACTTTAGGAGAGACA to mutant CtAAgGCcACTTTAGGAAAGACA. This mutation corresponds to a human coding variant potentially associated with increased susceptibility to familial Parkinsons disease. (J:101977)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count