CRISPR/cas9 genome editing used guide RNAs [ATCTTCCTGCATCAGAAGAG, AATTCGATATGAGTCCTTTC] to target exon 4. Donor DNAs were originally designed to introduce a R322X mutation. The resulting indel mutation was identified as an insertion of a G in exon 4 upstream of the intended mutation. (J:94077)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count