CRISPR/cas9 genome editing uses guide RNAs (GTGAGTCCATCCCAATGAGA, CTTTGCCCCTCTCATTGGGA, ACTCTGCCCTAATCACCTGA, and TCAACTCAGAGTGACCCTTC) to target exon 3. Donor DNAs including loxP sites were created 160 bp upstream of exon 3 and 120 bp downstream of exon 3. LoxP insertion sites are separated by 363bp. (J:101977)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count