CRISPR/cas9 genome editing is used to insert loxP sites flanking exon 2. The following guide RNAs were selected to target upstream [AAGTGTCCCCAAATATTGTC] and downstream [GCACCTAGCACATTGCCATG] of exon 2. Rag1 transcript Rag1-201 was used as reference for the exon numbering and the guide/donor sequences. (J:101977)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count