Nelfcd^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TAGCCTCTAAGTCTATTCAG and TCACTCCTCAGAGTGCAGAG, which resulted in a 318 bp deletion beginning at Chromosome 2 position 174,421,555 bp and ending after 174,421,872 bp (mm10). This mutation deletes ENSMUSE00001272679 (exon 4) and 208 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 105 and early truncation 5 amino acids later. (J:188991)