A single guide RNA (GCGGATGCCAGACATCCAGC) is used to create a 22 nucleotide deletion (AGCAGGTACTTCGTGCCCCTCG) in the first coding exon, immediately downstream of the start codon. The mutant protein is predicted to retain the first 17 amino acids followed by 49 aberrant amino acids prior to a stop codon. (J:288440)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count