Rnf187^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AAGTCCTTGGAACCTGGTCA and ATAAGATTACTCATCCTGCA, which resulted in a 6959 bp deletion beginning at Chromosome 11 position 58,823,054 bp and ending after 58,830,012 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000590381, ENSMUSE00000105447, ENSMUSE00000105448 and ENSMUSE00000678141 (exons 1-4) and 5010 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. There is a 1 bp (T) insertion at the deletion site. (J:188991)