This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCGTAGCCAACCAAACGCGA and TCTCGACCCCCAAAGTCAAG, which resulted in a 6894 bp deletion beginning at Chromosome 7 position 18,809,966 bp and ending after 18,816,859 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000676908, ENSMUSE00000198585, ENSMUSE00001284052, ENSMUSE00001300660 and ENSMUSE00000412301 (exons 1-5) and 2494 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. There is an 18 bp insertion AAGGCTCATCTACCAAAA at the deletion site. (J:188991)
Basic Information
Insertion, Intragenic deletion
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count