Rnf166^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGAGCACTATATGTCTTGCA and AGCAGTGGTCATGGCCCTAA, which resulted in a 490 bp deletion beginning at Chromosome 8 position 123,195,200 bp and ending after 123,195,689 bp (GRCm39/mm39). This mutation deletes ENSMUSE00001205147 (exon 3) and 377 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 103 and early truncation 34 amino acids later. (J:188991)