This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTAGGAATTGGGACACCCA and TGGAAATTTCCGAATAGCCG, which resulted in a 1621 bp deletion beginning at Chromosome 19 position 5,414,502 bp and ending after 5,416,122 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000145472 and ENSMUSE00000413957 (exons 2 and 3) and 961 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to create a null allele. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count