Introns 3 and 4 were targeted with two sgRNAs (targeting AAGAGGGGATCTCTGTCGTGGGG and CAGAGTGGAGTTCGGGAGTATGG) using CRISPR/Cas9 technology, resulting in the deletion of exon 4. Lack of peptide expression in T and B cells was experimentally confirmed. (J:282407)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count