The first and last exons were targeted with sgRNAs (targeting TCCGGCCGGGAGTCAGACGA and AAGGGCATGGTGGGTTGGCG ) using CRISPR/Cas9 technology, resulting in a 52579 bp deletion encompassing most of the gene. Absence of transcription from this allele was confirmed by RT-qPCR. (J:310647)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count