This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTTTGTTTCCTCTCAACGT and TTACATTATGGACTGCTATA, which resulted in a 490 bp deletion beginning at Chromosome 2 position 103,873,026 bp and ending after 103,873,515 bp (GRCm39/mm39). This mutation deletes ENSMUSE00001252280 (exon 4) and 375 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 119 and early truncation 17 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count