This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCACATTAACCGTGTATATG and TCTTCAGGAGATAAGCCCTT, which resulted in an 821 bp deletion beginning at Chromosome 1 position 55,187,235 bp and ending after 55,188,055 bp (GRCm39/mm39). This mutation deletes ENSMUSE00001214175 (exon 4) and 778 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 75 and early truncation 10 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count