Maco1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAATATGTTGCTTGGCTTG and TTATAACCACTGCTTCCCCC, which resulted in a 505 bp deletion beginning at Chromosome 4 position 134,563,412 bp and ending after 134,563,916 bp (GRCm39/mm39). This mutation deletes ENSMUSE00001289591 (exon 3) and 378 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 74 and early truncation 26 amino acids later. (J:188991)