Aspartic acid codon 270 (GAT) in exon 5 was targeted for change to asparagine (AAT)(p.D270N) with an sgRNA (targeting CTTCATAACTTCTGTAACTC) and an ssODN template using CRISPR/Cas9 technology. This mutation in the DEAH-box helicase catalytic site of the encoded peptide mimics one that is found in some inherited bone marrow failure (BMF) patients and renders the enzyme catalytic-dead. (J:311900)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count