Valine codon 66 (GTG) wast targeted for change to a methionine codon (ATG)(c.196G>A, p.V66M) with an sgRNA and an ssODN template (GAGCTGCTGGAGCAAATATTTTTCTGACAGCCCTTTTCTTTGCAGGTGACACTTGAGAAGATGCTTGGCATCACAGCCCAGAACAGCAGCGGGCTAACCTGTGACCCTGGCACAGGCCATG) using CRISPR/Cas9 technology. The mutation mimics the p.V65M mutation found in some patients presenting with microcephaly or cortical malformations. (J:285212)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count