CRISPR/cas9 guide RNA sequences (CCTGGTGAACCTGGTCAAGC and CCAGGGGGACCTTGGTATC) are targeted to exon 7 to introduce a glycine to serine substitution in amino acid 209 (G209S; nucleotide change GGT to TCT). The mutation is located at the beginning of the triple helical collagenous domain. This mutation is analogous to one found in Vascular Ehlers-Danlos syndrome (vEDS) patients. (J:312454)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count