CRISPR/cas9 guide RNA sequences (AGTGGTGCTCCTGGCAAGGA and ACAGCAATAGCTCTCACCGG) are targeted to exon 39 to introduce a glycine to aspartic acid substitution in amino acid 938 (G938D; nucleotide change GGT to GAT) at the end of the triple helical collagenous domain. This mutation is analogous to one found in Vascular Ehlers-Danlos syndrome (vEDS) patients. (J:312454)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count