Proline codon 1019 (CCT) in exon 29 was targeted for change to an arginine codon (CGT)(p.P1019R) with an sgRNA (targeting TTGAGAATACTCACAAGAGGAGG) and an ssODN template (ATTTCGAAGGCCAAAGAATATACATCTCCGAAATTTCTATATCATTGTTCGTCCTCTTGTGAGTATTCTCAAAACTAGAAGTGAGTTATTGATGGGTGTTAATACAGATTCAGTTTCCATAAAGCA) using CRISPR/Cas9 technology. The mutation mimics a mutation found in some human WiskottAldrich syndrome patients. (J:303795)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count