Proline and arginine (PPRP) codons 91-94 (CCCCCTCGACCG) in exon 2 were targeted for change to glycine-valine-alanine-alanine (GGTGTAGCAGCT)(p.P91_P94delinsGVAA)) with two sgRNAs (targeting GAGCAACAGGAAGCGGTCGA and TTTGAAGAACCCGGAGCAAC) and an ssODN template (GCTACAATGAAACCACTGGGGAGAGGGGAGACTTTCCAGGAACTTACGTTGAATACATTGGAAGGAAAAGAATTTCACCCCCTACTCCCAAGCCTCGGGGTGTAGCAGCTCTTCCTGTTGCTCCGGGTTCTTCAAAAACTGAAGCTGACACGGAGCAGCAAGGTCAGTATGATGAGTGGCTGGTTACTTAATGACCTTTT) using CRISPR/Cas9 technology. The mutation renders the encoded peptide more resistant to cleavage by anthrax lethal toxin. (J:304170)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count