Cysteine codon 234 (TGT) was targeted for change to a tryptophan codon (TGG)(p.C234W) with an sgRNA (targeting GTCTTCCTATATGATGACGC) and an ssODN template (TTTCCCTTCGGCTGGCTCATCTTCCAGTCTTCCTATATGATGACGTTAGTC). The mutation selectively abolishes the enzymatic activity needed to process C22 polyunsaturated fatty acids, while leaving other enzymatic activity intact. (J:284063)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count